|
Eurofins
il 6 nm 031168 probe eurofins 50cagataagctggagtcacagaaggagtgg 30 tnf alpha Il 6 Nm 031168 Probe Eurofins 50cagataagctggagtcacagaaggagtgg 30 Tnf Alpha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+30/pm30995475-232-95-98?v=Eurofins Average 86 stars, based on 1 article reviews
il 6 nm 031168 probe eurofins 50cagataagctggagtcacagaaggagtgg 30 tnf alpha - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
R&D Systems
recombinant mouse il 27 p28 ![]() Recombinant Mouse Il 27 P28, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+30/pm15528388-72-1-18?v=R%26D+Systems Average 92 stars, based on 1 article reviews
recombinant mouse il 27 p28 - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
R&D Systems
il 27 ![]() Il 27, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+30/pm40141330-598-35-58?v=R%26D+Systems Average 93 stars, based on 1 article reviews
il 27 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
R&D Systems
anti mil27 p28 il30 ![]() Anti Mil27 P28 Il30, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+30/10__1158_slash_2326___6066__cir___19___0748-82-17-20?v=R%26D+Systems Average 93 stars, based on 1 article reviews
anti mil27 p28 il30 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
R&D Systems
recombinant r murine m il30 ![]() Recombinant R Murine M Il30, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+30/10__1158_slash_0008___5472__can___17___3117-54-0-9?v=R%26D+Systems Average 93 stars, based on 1 article reviews
recombinant r murine m il30 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
R&D Systems
goat anti mouse il 27p28 ![]() Goat Anti Mouse Il 27p28, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+30/pmc03075503-145-41-47?v=R%26D+Systems Average 94 stars, based on 1 article reviews
goat anti mouse il 27p28 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
R&D Systems
mouse il 27p28 il 30 duoset elisa kit ![]() Mouse Il 27p28 Il 30 Duoset Elisa Kit, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+30/pm27183596-52-0-8?v=R%26D+Systems Average 93 stars, based on 1 article reviews
mouse il 27p28 il 30 duoset elisa kit - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
R&D Systems
il 27p28 ab ![]() Il 27p28 Ab, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+30/pm18619869-173-24-39?v=R%26D+Systems Average 90 stars, based on 1 article reviews
il 27p28 ab - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
R&D Systems
mouse il 27 p28 elisa kit ![]() Mouse Il 27 P28 Elisa Kit, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+30/pm19841177-99-5-10?v=R%26D+Systems Average 94 stars, based on 1 article reviews
mouse il 27 p28 elisa kit - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
R&D Systems
murine il 27 p28 il 30 antibody pairs ![]() Murine Il 27 P28 Il 30 Antibody Pairs, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+30/pmc10936422-225-8-14?v=R%26D+Systems Average 94 stars, based on 1 article reviews
murine il 27 p28 il 30 antibody pairs - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
R&D Systems
mouse l 27 p28 il 30 ![]() Mouse L 27 P28 Il 30, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+30/pm36241161-66-85-88?v=R%26D+Systems Average 92 stars, based on 1 article reviews
mouse l 27 p28 il 30 - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
R&D Systems
dy1834 ![]() Dy1834, supplied by R&D Systems, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il+30/pm37588169-140-91-88?v=R%26D+Systems Average 91 stars, based on 1 article reviews
dy1834 - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Journal of immunology (Baltimore, Md. : 1950)
Article Title: Suppression of ongoing experimental autoimmune encephalomyelitis by neutralizing the function of the p28 subunit of IL-27.
doi: 10.4049/jimmunol.173.10.6465
Figure Lengend Snippet: FIGURE 1. DNA vaccination-based anti-IL-27 Abs are highly specific. The Western blot shows that our DNA vaccination-based anti-IL-27 Ab binds mouse IL-27 p28 (lane 1; 27 kDa), but not recombinant mouse IL-18, IL-12, or TNF- (lanes 2, 3, and 4, respectively). A, Coomassie Blue staining verifies the appearance of each cytokine on the loaded gel. B, Western blot showing that of these cytokines, our DNA vaccination-based anti-IL-27 Ab binds only mouse IL-27 p28. These Ab also bound natural mouse IL-27 (verified by sequencing) from supernatant of activated MOGp35–55-specific cultured primary draining lymph node cells (not shown).
Article Snippet: Our
Techniques: Western Blot, Recombinant, Staining, Sequencing, Cell Culture
Journal: Journal of immunology (Baltimore, Md. : 1950)
Article Title: Suppression of ongoing experimental autoimmune encephalomyelitis by neutralizing the function of the p28 subunit of IL-27.
doi: 10.4049/jimmunol.173.10.6465
Figure Lengend Snippet: FIGURE 2. Anti-p28 Abs suppresses ongoing severe EAE. A, Four groups of 10 mice each were subjected to MOGp35–55-induced EAE. Beginning at the onset of disease (day 17), these mice were repeatedly (every other day) administered 100 g/mouse of anti-p28 Ab (f), IgG obtained from naive Lewis rats (Œ), or PBS (E). An observer blind to the experimental procedure scored EAE daily. The experiment summarized in Fig. 2 shows the results of one of three experiments performed under similar experimental conditions, with similar results. The mean maximal score SE represents six mice per group. The other four mice were killed on day 30 and subjected to histological evaluation (see Fig. 3). B, Five groups of six mice each were subjected to MOGp35–55-induced EAE. Beginning at the onset of disease (day 17), these mice were repeatedly (every other day) administered 100 g of anti-p28 Ab/mouse (f), anti-IL-18 Ab (F), anti-IL-1 Ab (), IgG obtained from Lewis rats previously subjected to an empty plasmid administration (Œ), or PBS (E). An observer blind to the experimental procedure scored EAE daily. Results are shown as the mean maximal score SE of six mice per group. C, Three groups of six mice each were subjected to induction of transferred EAE. Beginning at the onset of disease (day 5), these mice were repeatedly (every other day) administered 100 g of anti-p28 Ab/mouse (f), IgG obtained from naive Lewis rats (Œ), or PBS (E). An observer blind to the experimental procedure scored EAE daily. Results are shown as mean maximal score SE of six mice per group.
Article Snippet: Our
Techniques: Plasmid Preparation
Journal: Journal of immunology (Baltimore, Md. : 1950)
Article Title: Suppression of ongoing experimental autoimmune encephalomyelitis by neutralizing the function of the p28 subunit of IL-27.
doi: 10.4049/jimmunol.173.10.6465
Figure Lengend Snippet: FIGURE 4. The beneficial effect of anti-IL-27 is dependent on the con- tinuing administration of protective Abs. Three groups of six mice each were subjected to active induction of EAE. Beginning 1 day after the onset of disease (day 17), these mice were treated with either a single dose of anti-p28 Ab (100 g/mouse; E) or with repeated administration (every other day) of this Ab (Œ) or PBS (f). An observer blind to the experi- mental procedure scored EAE daily. Results are shown as the mean max- imal score SE of six mice per group.
Article Snippet: Our
Techniques:
Journal: Journal of immunology (Baltimore, Md. : 1950)
Article Title: Suppression of ongoing experimental autoimmune encephalomyelitis by neutralizing the function of the p28 subunit of IL-27.
doi: 10.4049/jimmunol.173.10.6465
Figure Lengend Snippet: FIGURE 3. Anti-IL-27 therapy reduces the histological score of EAE. Histological evaluation was conducted 30 days after disease induction. Lumbar spinal cord samples from naive mice or from EAE mice treated with PBS, IgG from naive mice, or anti-IL-27 p28 Abs were subjected to histological analysis (nine sections each group). The arrowheads point to the parenchymal mononuclear cell infiltration. The scale for mononuclear cell infiltration used was: 0, no mononuclear cell infiltration; 1, one to five perivascular lesions per section with minimal parenchymal infiltration; 2, five to 10 perivascular lesions per section with parenchymal infiltration; and 3, 10 perivascular lesions per section with extensive parenchymal infiltration. The mean histological score SE was calculated for each group.
Article Snippet: Our
Techniques:
Journal: Journal of immunology (Baltimore, Md. : 1950)
Article Title: Suppression of ongoing experimental autoimmune encephalomyelitis by neutralizing the function of the p28 subunit of IL-27.
doi: 10.4049/jimmunol.173.10.6465
Figure Lengend Snippet: FIGURE 5. Protective administration of anti-IL-27 Abs decreases in vivo polarization of CD4 T cells into Th1 and suppresses IFN- production by Ag-specific T cells. C57BL/6 mice (three per group) were subjected to active induction of EAE and then to repeated administration (days 12, 14, and 16) of anti-IL-27 p28 Abs (100 g), PBS, or normal rat IgG. On day 17 cervical lymph node cells (that drain the autoimmune site) were subjected to intracellular staining of IL-4 and IFN-. A, FACS analysis of CD4 T cells in this experiment. This experiment represents results obtained in three different independent experiments with very similar data. Subsequently, cervical lymph node T cells from these mice were cultured in the presence of 100 M MOGp35–55. After 72 h of stimulation, supernatants were assayed for the protein level of IFN- (B) and IL-4 (not shown). This experiment represents results obtained in three different independent experiments with very similar data.
Article Snippet: Our
Techniques: In Vivo, Staining, Cell Culture
Journal: Journal of immunology (Baltimore, Md. : 1950)
Article Title: Suppression of ongoing experimental autoimmune encephalomyelitis by neutralizing the function of the p28 subunit of IL-27.
doi: 10.4049/jimmunol.173.10.6465
Figure Lengend Snippet: FIGURE 6. Neutralizing the function of IL-27 reduces IFN- produc- tion by IFN--producing T cells. A, C57BL/6 mice (three per group) were subjected to active induction of EAE and then to repeated administration (days 3 and 6) of 100 g of anti-IL-27 p28 Abs (group 3), PBS (group 2), or normal rat IgG (group 1). On day 9, spleen cells were subjected to spot ELISA as previously described (38). A, Relative number of positive spots per 107 cultured cells. The average size of positive spots was analyzed. B, The MOGp33–55-specific CD4 T cell line was cultured with or without 100 M MOGp33–55. Cultured cells were supplemented with anti-IL-27 Abs at a final concentration of 10 g/ml (), normal rat IgG (f), or PBS (E). After 60 h of incubation, cells were plates in spot ELISA plates for an additional 24 h for the detection of IFN--positive spots (38). Number of positive spots (y-axis) and spot sizes (x-axis; logarithmic scale) determined as previously described (46).
Article Snippet: Our
Techniques: Enzyme-linked Immunosorbent Assay, Cell Culture, Concentration Assay, Incubation
Journal: Cancer Research
Article Title: Interleukin-30/IL27p28 Shapes Prostate Cancer Stem-like Cell Behavior and Is Critical for Tumor Onset and Metastasization
doi: 10.1158/0008-5472.can-17-3117
Figure Lengend Snippet: Figure 1. Expression of IL30 and IL30R by PCSLCs, murine, and human prostate tissues. A, Cytofluorimetric analyses of gp130-(CD130) and IL6Ra- (CD126) expression in PIN-SCs. B, Relative expression SD of IL30 mRNA. CTRL, PIN-SCs. ANOVA, P < 0.0001. , P < 0.01, Tukey HSD test compared with CTRL, EV, or EV-IL30shRNA (clones D and B). C, Western blot analyses of IL30 protein expression. D, ELISA assay of IL30 release by CTRL (182.82 6.9 pg/mL), EV-PIN-SCs (168.21 10.82 pg/mL), IL30PIN-SCs (2424.46 83.9 pg/mL), EV-IL30shPIN-SCs (170.44 13.09 pg/mL), and IL30shPIN-SCs (clone D, 6.76 1.87 pg/mL; clone B, 7.53 1.38 pg/mL). ANOVA, P < 0.0001. , P < 0.01, Tukey HSD test compared with CTRL, EV, or EV-IL30shRNA (clones D and B). E, IL30 immunostaining in normal prostate, PIN (11 weeks), and in poorly differentiated tumor (28 weeks) of TRAMP mice. IL30 (brown) colocalizes with Sca-1 (red) in PIN; scale bars, 50 mm (left two); 30 mm (right two and inset). F, Expression of IL6Ra and gp130 in PIN and in poorly differentiated adenocarcinoma (AC) of TRAMP mice; scale bars, 50 mm (left two); 30 mm (right two). G, IL30 immunostaining in normal prostate, PIN (IL30/CD133 colocalization), and in poorly differentiated adenocarcinoma; scale bars, 20 mm (left two and inset); 30 mm (right two).
Article Snippet:
Techniques: Expressing, Clone Assay, Western Blot, Enzyme-linked Immunosorbent Assay, Immunostaining
Journal: Cancer Research
Article Title: Interleukin-30/IL27p28 Shapes Prostate Cancer Stem-like Cell Behavior and Is Critical for Tumor Onset and Metastasization
doi: 10.1158/0008-5472.can-17-3117
Figure Lengend Snippet: Figure 3. Effects of IL30 overproduction or silencing on subcutaneous PCSLC-derived tumors. A, Histology and immunohistochemistry of IL30PIN-SC and IL30shPIN-SC tumors versus controls; scale bars, 50 mm (bottom); 30 mm (other and inset). B, Immunohistochemical features of IL30PIN-SC and EV-IL30PIN-SC tumors; scale bars, 30 mm; 20 mm (granulocytes). C and D, Immune cells in IL30–overexpressing (C) or IL30-silenced (D) PIN-SC tumors. Results are expressed as mean SD of positive cells/field evaluated at 400 (0.180 mm2 field) by immunohistochemistry. , values significantly (P < 0.05) different from controls. H&E, hematoxylin and eosin.
Article Snippet:
Techniques: Derivative Assay, Immunohistochemistry, Immunohistochemical staining
Journal: Cancer Research
Article Title: Interleukin-30/IL27p28 Shapes Prostate Cancer Stem-like Cell Behavior and Is Critical for Tumor Onset and Metastasization
doi: 10.1158/0008-5472.can-17-3117
Figure Lengend Snippet: Figure 4. IL30's ability to regulate gene expression of PCSLCs and PCSLC-derived tumors. A, Fold differences of mRNAs between rIL30–treated and untreated PIN-SCs. A significant threshold of 2-fold change in gene expression corresponded to P < 0.001. B, Fold differences of mRNAs between IL30shPIN-SCs and EV- IL30shPIN-SCs. Results from the latter are comparable to those from untransfected cells. A significant threshold of 2-fold change in gene expression corresponded to P < 0.001. C–E, Immunohistochemical features of prostate draining LNs, IL30PIN-SC, and EV-IL30PIN-SC orthotopic tumors; scale bars, 30 mm. F, Silencing of STAT1 and STAT3 in PIN-SCs, as confirmed by Western blot. G, Fold differences of mRNAs between Stat1 siRNA- or Stat3 siRNA- or CTRL siRNA-transfected PIN-SCs cultured with rIL30 and untreated CTRL siRNA-transfected PIN-SCs. Results from the latter are comparable with those from untreated and untransfected cells. A significant threshold of 2-fold change in gene expression corresponded to P < 0.001. , P < 0.05 by Student t test compared with rIL30–treated CTRL siRNA-transfected PIN-SCs. H, Fold differences of mRNAs between Stat1 siRNA- or Stat3 siRNA-transfected PIN-SCs cultured with rIL30 and rIL30–treated CTRL siRNA-transfected PIN-SCs. A significant threshold of 2-fold change in gene expression corresponded to P < 0.001.
Article Snippet:
Techniques: Gene Expression, Derivative Assay, Immunohistochemical staining, Western Blot, Transfection, Cell Culture
Journal: Cancer Research
Article Title: Interleukin-30/IL27p28 Shapes Prostate Cancer Stem-like Cell Behavior and Is Critical for Tumor Onset and Metastasization
doi: 10.1158/0008-5472.can-17-3117
Figure Lengend Snippet: Figure 5. IL30 favors PCSLC metastasis to the lungs involving CXCR4/CXCL12 axis. A, Histology and immunohistochemistry of lung metastasis in IL30PIN-SC and EV-IL30PIN-SC tumor bearing mice. Scale bars, 50 mm (bottom); 30 mm (other). B, Expression of CXCR4 and CXCL12 in lung metastasis developed in IL30PIN-SC and EV-IL30PIN-SC tumor-bearing mice; scale bars, 30 mm. C, Migration of IL30–treated PIN-SCs toward CXCL12. Results are expressed as mean SD. ANOVA, P < 0.0001. , Tukey HSD test compared with CTRL and rIL30þAb-CXCR4 (P < 0.05) or EVsup and IL30LV-DNAsupþAb-CXCR4 (P < 0.01). , P < 0.01, Tukey HSD test compared with CTRL, rIL30þAb-CXCR4, EVsup, and IL30LV-DNAsupþAb-CXCR4. , Tukey HSD test compared with CTRL, rIL30þAb-CXCR4, EVsup, and IL30LV- DNAsupþAb-CXCR4 (P < 0.01) or IL30LV-DNAsup (P < 0.05). D, Histology and immunohistochemistry of lung metastasis in mice bearing orthotopic IL30PIN-SC and EV-PIN-SC tumors; scale bars, 50 mm; 30 mm (bottom and insets). E, Immune cells in lung metastasis of mice bearing orthotopic IL30PIN-SC tumors versus controls. Results are expressed as mean SD of positive cells/field (400) evaluated by immunohistochemistry. , values significantly (P < 0.05) different from values in EV-PIN-SC and PIN-SC tumors. H&E, hematoxylin and eosin.
Article Snippet:
Techniques: Immunohistochemistry, Expressing, Migration
Journal: Cancer Research
Article Title: Interleukin-30/IL27p28 Shapes Prostate Cancer Stem-like Cell Behavior and Is Critical for Tumor Onset and Metastasization
doi: 10.1158/0008-5472.can-17-3117
Figure Lengend Snippet: Figure 6. IL30 promotes PCSLC dissemination in the LNs and bone marrow involving CXCR5/CXCL13 upregulation. A, Histology and immunohistochemistry of IL30PIN-SC orthotopic tumors. Isolated Sca-1þ/IL30þ cells (red arrow) inside the blood vessels; scale bars, 50 mm (left); 20 mm (right). B, Immunohistochemistry of LNs draining IL30PIN-SC or EV-IL30PIN-SC orthotopic tumors. The inset shows CK5/6 staining of the primary tumor. In LNs, CK5/6þ colocalizes with Sca-1; scale bars, 30 mm; 20 mm (bottom). C, Immunohistochemistry of bone marrow from mice bearing IL30PIN-SC and PIN-SC orthotopic tumors; scale bars, 50 mm (top); 30 mm (bottom). D, Migration of IL30–treated PIN-SCs toward CXCL13. Results are expressed as mean SD. ANOVA, P < 0.0001. , Tukey HSD test compared with CTRL and rIL30þAb-CXCR5 (P < 0.05) or EVsup and IL30LV-DNAsupþAb-CXCR5 (P < 0.01). , Tukey HSD test compared with CTRL, rIL30þAb-CXCR5, EVsup, and IL30LV-DNAsupþAb-CXCR5 (P < 0.01) or IL30LV-DNAsup (P < 0.05).
Article Snippet:
Techniques: Immunohistochemistry, Isolation, Staining, Migration
Journal: Immunity
Article Title: Engagement of the type I interferon receptor on dendritic cells inhibits T helper 17 cell development: role of intracellular osteopontin.
doi: 10.1016/j.immuni.2008.05.008
Figure Lengend Snippet: Figure 7. Microglia Require Opn-i Expression to Induce Th17 Cells Opn-deficient microglia were infected with lenti-Opn-i or lenti-GFP and incubated 2D2+CD4 T cells and MOG peptide. (A and B) Reconstitution of Opn-deficient microglia with Opn-i rescues IL-17 production by CD4+ 2D2 T cells. (A) IL-17 concentrations in culture supernatants 24 hr after T cell restimulation on day 4 were determined by ELISA in triplicate wells. (B) Concentrations of IL-27p28 in day 4 cultures before T cell restimulation. The amounts of IL-27p28 were determined by ELISA in triplicate wells; empty and filled bars denote supernatants from Opn-i-transfected and GFP-transfected DC, respectively, and data are representative of two experiments. (C) EAE development is inhibited in irradiated Opn-deficient hosts. Total BM cells (1.7 3 107 cells/mouse) from 2D2+ Tg Opn-deficient mice were i.v. trans- ferred to irradiated (800 rads) hosts. Ten weeks later, EAE was induced. Disease development (mean clinical score) and incidence (%) is shown for each group (n = 5). Error bars in disease score denote mean ± SEM and t test values on the last day of observation are shown. Mice displayed >95% engraftment of donor bone marrow according to immunofluorescence with Ly5.2 Ab (donor BM cells were obtained from B6.Ly5.2+ Opn-deficient mice expressing the 2D2 TCR transgene) 10 weeks after reconstitution and before disease induction, as judged by immunofluorescence of peripheral blood cells.
Article Snippet: Antibodies to IL-17 (TC1118H10) and IFN-g (XMG1.2) for flow cytometry were from BD PharMingen; Foxp3 (FJK-16 s) and IL-10 (JES5-16E3) Abs were from eBioscience;
Techniques: Expressing, Infection, Incubation, Enzyme-linked Immunosorbent Assay, Transfection, Irradiation